Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ628174
Length 815 bp
Fasta Format > whcs14i02
aagccgtgaggaagctcaaacttgacgcaatcgctgctaagcagctgcag agggagagggagttagaagagagggagaaacagagaagggaggctctcct aagaggagcagagcccgtgcgcgcagctgatgcaccagctgctgctgctg tcgcaccgccagcccgtgaaccagcagcggcagccccagctgcagcagct gcagcaactggtgctgctcctagcaagtatgtcccaaagtggaaacgtga gggtgatagtagcagtcagaggccgactgcggcagctgaaccagaccggt gggtccgggatgatcgtcctcgccctgccctccgccaggatgctcctcct gtgcgcgatgctcgtcccatccgccaagaagctcctcctgcacgtgatgc gcgtcccttccgccaggaggctcctcccgccgcacgccaagaggcgcccc ctgctgcccgccagccggacggtgctgctccagctgcatctactgaacgc tggcgtcctggatctaggacctctgcaaattcctcatccacctcctcgtc caccggctggaggcgctgaagctgcctggcctgaaatgcgctgtgctctg cccgctgtctgagatttttgccgtcctacttccatgtcttggagcttcat gcacaatggaagtctgccactgatatctgggagcacggttacttgaattt gcttgttgcgcacctaaattttcnaattgaaaccttgcactgtttctcan tcatgtttgatgttttganantcacantactccatgcataatgtgttgct ctttgttggcntaaa
Download
page-top