Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ627810
Length 743 bp
Fasta Format > whcs13b18
aagaacaccaaggactgactgccagcgcctctccgcgatccaaatcctcc cgggaaagttcttggttgatctcttcctcctcgaccgcctcccaggttct tggtgtagcttttgccactctcaccaggagatttcatgtctgatcttgac gttcagatcccaactgcctttgacccctttgccgaggcgaatgctgggga cgctggtgcagctgccggatcaaaagactacgttcatgtacgcatccagc agcgtaatggtcgcaagagcctgaccactgtccagggcctgaagaaggag ttcagctacagcaagatcctcaaagacctcaagaaagagttttgctgcaa tggtacagttgtccaggacacagaacttggacaggtcattcaactccagg gtgatcagaggaagaacgtctcaaacttccttgtccaggccggcattgtg aagaaggaacacatcaagattcatggtttctgaacaactgccagctccat atcagagtctacatgcaaagcagctatatattggtggtgcagtatattta gttgtgtgctagcgcaagcaggcgttaccagcttgcgcgctctgagtata cggaaaatctagcatagcccacctctctgcgtgtatgcttgttacccttg tgttgaaactttgtaaggagcaccatcgttagatggcttgttaccctctc ccatcaaggttgaataataatatatgctttcttaaaaaaaaaa
Download
page-top