Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ631905
Length 515 bp
Fasta Format > whcs9j21
gaaccggaaatggcggcgcggcacctcanatccggcctcccgctcctcca agctcgcctcgcggccaacgaatccgcggccgtcgctcaggtatcgaggg ggctggcaacggaggcggataagcctaaggagaacaagatcaaggttcca aaagctctgtatggtggcaccggcaactatgctagtgcgttgttccttgc agcagccaacgcaaattcgttggaaaaagttgaatccgagattctcgatg ttgtaggggcatccaagaagagccctatgttttctcaattcatgaaggac acatcagtgcctaaagaaaccagggtgaaggctataactgaaatattctc tgaagccgggtttactgacatcacaaagaaattcttgtctgcactggcat ccaatggaagactgaaatatgttgagcgcattgctgagagatttgttgat ttgaccatggcacataggggggaggtgaaagttgttgtcnggactgttgt tccacttcctgataa
Download
page-top