Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ631895
Length 760 bp
Fasta Format > whcs9j05
gccacccaaagaggaggaagaacaccaaggactgactgccagcgcctctc cgcgatccaaatcctcccgggaaagttcttggttgatctcttcctcctcg accgcctcccaggttcttggtgtagcttttgccactctcaccaggagatt tcatgtctgatcttgacgttcagatcccaactgcctttgacccctttgcc gaggcgaatgctggggacgctggtgcagctgccggatcaaaagactacgt tcatgtacgcatccagcagcgtaatggtcgcaagagcctgaccactgtcc agggcctgaagaaggagttcagctacagcaagatcctcaaagacctcaag aaagagttttgctgcaatggtacagttgtccaggacacagaacttggaca ggtcattcaactccagggtgatcagaggaagaacgtctcaaacttccttg tccaggccggcattgtgaagaaggaacacatcaagattcatggtttctga acaactgccagctccatatcagagtctacatgcaaagcagctatatattg gtggtgcagtatatttagttgtgtgctagcgcaagcaggcgttaccagct tgcgcgctctgagtatacggaaaatctagcatagcccacctctctgcgtg tatgcttgttacccttgtgttgaaactttgtaaggagcaccatcgttaga tggcttgttaccctctcccatcaaggttgaataataatatatgctttctt aaaaaaaaaa
Download
page-top