Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ631878
Length 797 bp
Fasta Format > whcs9i05
aagcaagaagtccgcggcccctactgttcgtggcgccggcggccgtcctt accaaggggaaggccgggaagaagcgcgaagccgatgacgagatcaagaa ggctgtaagcgcaaagaaacagaaggctgcgccggcaaaggcggtgcccg ggcccaaagaggccgccaagaaggccaagaagcagccgccgcccaagaag gttgagagcagcagctctgaggagcagtcatccgagtccgaggaggagga ggttcctaagaagactgcaaagcctgtcaaacacgagtcttcagatgata gcagcgacgattcctcctctgacgaggaacctgcaaagaagccttctgct aaacctgtgaccccagctgccagcaacggctcaaagaaaggcaagcctga gagcagctcttctagttctgaggatgagtccgatgatgacgagaaacctg ctgctctggtaaagaaaacaccagtcatcgaatctgacagctccgaaagt gactcagatgatagctcagatgaggatgttcctgccaagactcctgctgc tgctgccaagaaggtagattcttcagacagttctgagtcggagagtgaat ctgaggatgaggagaagtcaaagaaagccgcacaggccaccaagatagct cctgcagctgctaaaagaaaggaggagcccagtgattcctcanacagtga tganagtgatgaanagcctccccanaaaaagctgaaggatgctgcgaagg ttactcctaantctgccaaaaaaggacagcaccantgatgatgacag
Download
page-top