Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ631162
Length 840 bp
Fasta Format > whcs6l20
gtgatgatgacagttctgatgaaagctctgatgatgagcctaaaaagaaa gttacaactgcctcaaaatcacagaaggaagagcctaaaactcctgctag caacaaaggtcaggcaacagggtcgaagaccctttggatggggaaccttt ccttcaatattgagtatgatcaagtgaagcaattttttgcacaaattgga gaggtcgttgatgttcgcctggctacccatgaagatggccatcccaaggg atttggtcatgttgagtttgctacggctgaagatgctcagaaagcgcttg attcactgaatggtggagatctaatgggccgtccggtgagacttgacatg gctgctgaaagaggtgcaactcctcgcaccagggatggtggatcgtttgg aaaaccaagtggaggtcccagcctctcagtatttgtcaagggttttgatt catctcaacaggaggatgctattcggagctctcttcaagaacacttctct aaatgtggagaaatcacacgtgtctcagttccgatggattatgagaatgg tgcaagcaaagggatagcttacatggattttactgatgagagttcctttt cgaaagcacttgagcttagtggatctgacctaggtggctgcaacttgtat gttgctgaagctaagcctaagggtcaatttggtggcgttggtggtcgatc tggtggcagagatggtggccgctctggtggtggcaggtttggccggtctg gtggccgtgatggcggcggcaggtttggccggtctggtggccgtgatggt ggccggcangtttggccggtctggtggccntgatggcngc
Download
page-top