Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ631079
Length 804 bp
Fasta Format > whcs6g18
aacccccatccgttccgtccgtcccggggaggagaggagacgcgggcgag gcaagaggagagtcaaatccccatcttgctcccccccccgcgccgccgac cccacccgcggcattctctccggcgtccctcctccggccagggggaaaag cagcagcaggatggtgctgtgggtcttcgggtatgggtccctgatctgga accccggattcgacttcgacgagaagatcctgggattcatcaagggatac aagcgaacgtttaatcttgcttgcattgaccatagaggcacaccacagca tccggccaggacctgcacccttgaatccgaagatgaagccatatgctggg gaattgcttattgtgtcaaaggtggtctagaaaaagagcgagaagcaatg cagtacttggagagaagagaatgcgagtatgaccagaagatctctgtgga tttctacaaggatggaaattctctggaaccagctgtgacggatgtattag ttttcgtatccactcctgatccagttggcaacaaatactatcttggccct gctgctttggaggatatggcaaggcaaattgctacagccagtggccctaa tggatataatagggactacctgttctcaatggagaaggcactgtccaata taagccatgaagacgactcgatcattgtgcttgcggatgaggtgaggaag gtgctgagcaggtcgacggagaagaaggttaccggctccgacataccatt aaaatcgcatacacctgttgtgcacatctctgctcttcctgagggcaccg ttgc
Download
page-top