Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ631059
Length 820 bp
Fasta Format > whcs6f07
ccttctgctaaacctgtgaccccagctgccagcaacggctcaaagaaagg caagcctgagagcagctcttctagttctgaggatgagtccgatgatgacg agaaacctgctgctctggtaaagaaaacaccagtcatcgaatctgacagc tccgaaagtgactcagatgatagctcagatgaggatgttcctgccaagac tcctgctgctgctgccaagaaggtagattcttcagacagttctgagtcgg agagtgaatctgaggatgaggagaagtcaaagaaagccgcacaggccacc aagatagctcctgcagctgctaaaagaaaggaggagcccagtgattcctc agacagtgatgagagtgatgaagagcctccccagaaaaagctgaaggatg ctgcgaaggttactcctaagtctgccaaaaaggacagcaccagtgatgat gacagttctgatgaaagctctgatgatgagcctaaaaagaaagttacaac tgcctcaaaatcacagaaggaagagcctaaaactcctgctagcaacaaag gtcaggcaacagggtcgaagaccctttggatggggaacctttccttcaat attgagtatgatcaagtgaagcaattttttgcacaaattggagaggtcgt tgatgttcgcctggctacccatgaagatggccatcccaagggatttggtc atgttgagtttgctacggctgaagatgctcagaaagcgcttgattcactg aatggtggagatctaatgggccgtccggtgagacttgacatggctgctga aagaggtgcaactcctcgca
Download
page-top