Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ630976
Length 764 bp
Fasta Format > whcs6a01
aaccactctccctatccccgtgtccagaatctaccccccggctccaatgg cggcgaaggaaccgatgcgcgtgctcgtcaccggcgccgcaggacaaatc ggatatgctcttgttcccatgattgccaggggagttatgcttggtgcaga ccagcctgttattctgcatatgctggatattgaatttgctgctgaagctc ttaaaggcgtcaagatggagttgatcgatgccgcatttccacttctcaag ggagttgttgcaacaactgatgttgttgaggcttgcactggtgtgaatgt tgcggttatggttggtggattccccaggaaggaaggaatggaaaggaagg atgttatgacgaaaaatgtttcaatctacaaagctcaagcatctgctctt gaagctcatgcagcccccaattgcaaggttttggttgttgccaacccagc aaacaccaatgctctcatcctgaaggagtttgctccatctatccctgaga agaacatcagttgtttgacccgcctagaccacaacagggcactcggtcag atttctgagagacttggtgtccaagtttctgacgttaagaatgctattat ctggggtaatcactcgtccagtcagtatcctgatgttaaccatgccactg tgaagactcccagtggagagaagcctgttcgtgaacttgttcaagatgat gaatggctaaatggggagttcattgccactgtccagcagcgtggtgctgc aatcatcaaagcga
Download
page-top