Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ630853
Length 874 bp
Fasta Format > whcs5h19
tccgctcccctacactccctccttgcctctacgccgccagcggtccatgg gcaagtcaagcaagaagtccgcggcccctactgtcgtggcgccggcggcc gtccttaccaaggggaaggccgggaagaagcgcgaagccgatgacgagat caagaaggctgtaagcgcaaagaaacagaaggctgcgccggcaaaggcgg tgcccgggcccaaagaggccgccaagaaggccaagaagcagccgccgccc aagaaggttgagagcagcagctctgaggagcagtcatccgagtccgagga ggaggaggttcctaagaagactgcaaagcctgtcaaacacgagtcttcag atgatagcagcgacgattcctcctctgacgaggaacctgcaaagaagcct tctgctaaacctgtgaccccagctgccagcaacggctcaaagaaaggcaa gcctgagagcagctcttctagttctgaggatgagtccgatgatgacgaga aacctgctgctctggtaaagaaaacaccagtcatcgaatctgacagctcc gaaagtgactcagatgatagctcagatgaggatgttcctgccaagactcc tgctgctgctgccaagaaggtagattcttcagacagttctgagtcggaga gtgaatctgaggatgaggagaagtcaaagaaagccgcacaggccaccaag atagctcctgcagctgctaaaagaaaggaggagcccagtgattcctcaga cagtgatgagagtgatgaagagcctccccagaaaaagctgaaggatgctg cgaaggttactcctaagtctgccaaaaaggacagcaccagtgatgatgac agttctgatgaaagctctgatgat
Download
page-top