Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ630734
Length 753 bp
Fasta Format > whcs4p09
agccgcctcccgcacgcttctcctccgcctcgagcagctcagggacgcgc gcagccatggcgacggagaccgagaccttcgccttccaggccgagatcaa ccagctcctctcgctcatcatcaacaccttctactccaacaaggagatct tcctccgcgagctcatctccaactcctccgatgccttggacaagatcagg ttcgagagcctcacggacaagagcaagctcgatgcgcagcccgagctctt catccacatcatccccgacaaggcgaccagcacgctcacgatcgtcgaca gcggcattggcatgaccaagtcggacctcgtcaacaacctcgggaccatc gccaggtcggggaccaaggagttcatggaggcactcgctgccggcgctga cgtgtccatgattgggcagttcggtgttgggttctactccgcctacctcg tcgccgagagggtcgtcgtcaccaccaagcacaacgacgacgagcagtac gtgtgggagtctcaggccggtggctccttcaccgtcactcgtgatacgtc tggggagcagctcggcaggggtaccaagatggtgctctacctcaaggacg accagatggaataccttgaggagcgccgcatcaaggatctagttaagaag cactctgagtttatcagctaccccatctccctgtggaccganaagaccac tganaaggaaatttctgacgatgaagatgaggaggagaagaangatactg agg
Download
page-top