Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287900
Length 521 bp
Fasta Format > whsl11j08
cacgagggtttcagttctcctccgcctccggtctcgagnagctcgccagg aatggtcgcccacaggttccaccagtaccaggtggtgggtcgcgcgctgc cggcccccggcgatgagcagcccaagatctaccgcatgaagctctgggcc accaatgaggtccgcgccaagtccaagttctggtacttcctgaggaagct caagaaggtgaagaaggccaacggccagatgctcgccatcaacgagatct ttgagaagaaccccaccacaatcaagaactacggcatctggctgaggtac cagagcaggaccggttaccacaacatgtacaaggagtaccgtgacacgac cctcaacggcggggtggagcagatgtacacggagatggcgtcgcggcacc gcgtgcgtgccccctgcatccagatcatcaagactgcgacggtggacttc aagctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaa gttcccgctggtgtaccagaa
Download
page-top