Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ630390
Length 766 bp
Fasta Format > whcs3j04
gctcgggagccggaagcgaaaccccaaggctactgttagtcctggcgtga cattcaaaagcagatcaagatggtgaagttcacagcggaggagctccgtg gaattatggataaaaagaataatattcgtaacatgtctgttattgctcat gttgaccacggcaagtctacgcttacggattcccttgtggcagctgctgg gattatcgcccaggaagttgctggtgatgttcgcatgactgatacccgtg cagatgaggcagaacgtggtattacaatcaaatccacgggtatctctctg ttctatcagatgactcctgaatcacttgagatgtacaagggcgacaggga tggggatgaatacctgatcaaccttattgactcacctggtcacgttgact tctcttcggaagtgacagctgctcttcgtatcactgatggtgctttggtg gtggttgactgtattgagggtgtctgtgtgcagaccgaaactgtgctgcg ccaagctcttggtgagaggattangcctgtcctcaccgtgaacaagatgg acagatgcttccttgagcttcaagtggaaggtgaggaagcataccanact ttctcccgtgtcattgaaaatgccaatgtcatcatggcaacatatgaana tgtgctccttggtgatgtccaantgtacccnnnanaangggactgttgca ttctctgctggnttgcatgggtggnctttcnccccttncnaacttccnta anatgnatncctccna
Download
page-top