Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ630383
Length 255 bp
Fasta Format > whcs3i19
aaaaggaggaggctaaggaanagagcgatgatgacatgggcttcagcttg ttcgactaagcagttcaattccagttctcctgtggaatcttttatgctaa ggattacttatcttatgtgcttttaggtcgaattttgcggatttaatatg tttgagacctaantatctgtgcaatgagtactgcaaaccaccttgggatg gtctttttagantgaaaatggttttggngcttggttgaanagccaaaaaa aaaaa
Download
page-top