Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ630328
Length 844 bp
Fasta Format > whcs3f04
cgccgccagcggtccatgggcaagtcaagcaagaagtccgcggcccctac tgtcgtggcgccggcggccgtccttaccaaggggaaggccgggaagaagc gcgaagccgatgacgagatcaagaaggctgtaagcgcaaagaaacagaag gctgcgccggcaaaggcggtgcccgggcccaaagaggccgccaagaaggc caagaagcagccgccgcccaagaaggttgagagcagcagctctgaggagc agtcatccgagtccgaggaggaggaggttcctaagaagactgcaaagcct gtcaaacacgagtcttcagatgatagcagcgacgattcctcctctgacga ggaacctgcaaagaagccttctgctaaacctgtgaccccagctgccagca acggctcaaagaaaggcaagcctgagagcagctcttctagttctgaggat gagtccgatgatgacgagaaacctgctgctctggtaaagaaaacaccagt catcgaatctgacagctccgaaagtgactcagatgatagctcagatgagg atgttcctgccaagactcctgctgctgctgccaagaaggtagattcttca gacagttctgagtcggagagtgaatctgaggatgaggagaagtcaaagaa agccgcacaggccaccaagatagctcctgcagctgctaaaagaaaggagg agcccagtgattcctcanacagtgatganagtgatgaanagcctccccan aaaaagctgaaggatgctgcgaaggttactcctaagtctgccaaaaaagg acagcaccantgatgatgacagttctgatgaaaagctctgatga
Download
page-top