Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ627736
Length 809 bp
Fasta Format > whcs12m14
tcctagaagtgattccagcggctgaatctgcgtcagctgctgagatggcc acacccgaggttcaccaggatggtggtttagaaaatttatcctcggtagc agatgctctaactttgatgtcgctgtattttgctctgtgtaccaagaagc actcccttctccgacgtgtatttgaaatatatggcagtcttccacaggct gccaaacaggcagttcacagacaagtacccattctgattcgcacgatacg ttcctctcctgaccttcttggtatcatctcagatccaccagctgactgtc ggggcctactcatgcaggttttacagactctcactgatggtgcagtgcca tctcaagatctgatttcttccataaagaacttatattcaaaaactaagga tactgagttccttttcccagtcatggctcatctgccaaaagatgagattc tgtctgtgtttcccaatattgttaatcttccggtggataagtttcaagtt gccctttctcgaatcctgcagggatcaccacaacatggccctattcttga cccatcagaaattttgattgcgattcatgtaatagatcctgaaaaagaag gaataccactgaaaaaggttatggatgcatgtgctgcctgcttcgagcag aggacaacattcactcagcaagttttggcaaaagcactaaaccaactggt tgaacagattcccctacctttgctgttcatgcgaactgttatgcaagcga taagtgcatttcctgccttggtggattttgtgatggagatcatgtcacgc cttgttaac
Download
page-top