Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ627714
Length 815 bp
Fasta Format > whcs12l04
ccgcactccctccttgcctctacgccgccagcggtccatgggcaagtcaa gcaagaagtccgcggcccctactgtcgtggcgccggcggccgtccttacc aaggggaaggccgggaagaagcgcgaagccgatgacgagatcaagaaggc tgtaagcgcaaagaaacagaaggctgcgccggcaaaggcggtgcccgggc ccaaagaggccgccaagaaggccaagaagcagccgccgcccaagaaggtt gagagcagcagctctgaggagcagtcatccgagtccgaggaggaggaggt tcctaagaagactgcaaagcctgtcaaacacgagtcttcagatgatagca gcgacgattcctcctctgacgaggaacctgcaaagaagccttctgctaaa cctgtgaccccagctgccagcaacggctcaaagaaaggcaagcctgagag cagctcttctagttctgaggatgagtccgatgatgacgagaaacctgctg ctctggtaaagaaaacaccagtcatcgaatctgacagctccgaaagtgac tcagatgatagctcagatgaggatgttcctgccaagactcctgctgctgc tgccaagaaggtagattcttcagacagttctgagtcggagagtgaatctg aggatgaggagaagtcaaagaaagccgcacaggccaccaagatagctcct gcagctgctaaaagaaaggaggagcccagtgattcctcanacagtgatga nagtgatgaanagcctccccagaaaaagctgaaggatgctgcnaaggtta ctcctaagtctgccc
Download
page-top