Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ627703
Length 787 bp
Fasta Format > whcs12k05
gccgccgcttcctcatctcatcctcccggatcgggaggcggaagccaagc cccaagaaacttaaattctcggtgtgatattcaaaagcagtcaagatggt gaagtttaccgcggaggagctccgtggaattatggacaaaaagaataata tccgtaacatgtctgttattgctcatgttgaccatggcaaatctacgctt acggattcccttgtggcagcagctgggattattgcccaggaagtagctgg tgatgttcgcatgaccgatacccgtgcagatgaggcagaacgtggtatta caatcaaatccacgggtatctctcttttctatcagatgactcctgaatca cttgagatgtacaagggcgacagggatggtgatgagtacctgatcaacct tattgattcacctggccacgttgacttctcttcagaagtcacagctgctc ttcgtatcaccgatggtgctttggttgttgttgactgtattgagggtgtc tgtgtgcagactgaaactgtgctgcgccaagctcttggtgagaggattcg gcctgtcctcaccgtgaacaagatggacagatgcttccttgagcttcaag tggaaggtgaggaagcatatcagactttctcccgtgtcattgaaaatgcc aatgtcatcatggcaacatatgaagatgtgctccttggtgatgtccaagt gtacccagagaaggggactgttgcattctccgctggtttgcatgggtggg ctttcacccttacaaactttgcctaanatgtatgcct
Download
page-top