Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ627381
Length 794 bp
Fasta Format > whcs11f05
agcggcggcgaagatggtgtcgctgaagctgcagaagcgcctggcctcga gcgtcctcaagtgcggcaagggcaaggtctggctcgaccccaatgaggtc aacgagatctccatggccaactcccggcagaacatccggaagctggtaaa ggatggtttcatcatcaggaagcctcagaagatccactccaggtctcgtg caaggagggcacatgaggccaagcagaagggccgtcactctggatatggt aagcgtaggggtaccagggaggctaggctccccaccaagatcctgtggat gcggaggatgcgcgtcctgaggcgccttctgcgcaagtaccgtgaggcca agaagatcgacaagcacatgtaccatgacatgtacctgaaggtcaagggt aacatgttcaagaacaagagggtcctcatggagagtatccacaagtccaa ggctgagaaggcaagagagaagaccctctctgatcagtttgaggccaagc gcgccaagagcaaggcaagcagggagaggaagcatgccaggagggaggag agattggctcagggccccagagatcatgcaccagcaccagcggctgcagc tccagctccagcagcagcggcaccaaagaaggccaaggccaagaagtgaa ggtctgacatgaagctttanctttctggtatcatgaagggttancctgat tttggagcatctgaagttcanaactgttttctgtgcaatatctgtgtgcc gcgtatganataccttaaatatcatatcntgtttgttctgttgg
Download
page-top