Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ627281
Length 819 bp
Fasta Format > whcs10o15
cacgctgcgtgaaggaaacgttacacatcatgaatacatgcaagttggca agggaagagatgttggtctcaaccagatttcactattcgaggcaaaaatt gcgtatggtaatggcgaacagacactgagccgtgacatctaccgacttgg gcatcgttttgatttcttcagaatgttgtcctgctactacactactattg gcttctacttcagcacaatgattacggtatggaccgtgtatgtatttctc tatgggcgtctgtatcttgtcctcagtgggcttgataaaggactagccac tggaagaaggtttatacacaatgaccctctccaagtcgctctcgcttcgc aatcttttgttcagcttggcttcttgatggcgctccctatgatgatggag atcggtctggagagagggttcaggaccgcgttgagcgactttgtgctcat gcagcttcagttagcgtccgtcttcttcacattctccctcggaaccaaga ctcactactacggaaagacgctgctccacggaggagccgagtacagagcc accggacgtggattcgtggtgttccatgccaaattcgccgagaactatcg actgtactcacggagccatttcgtcaagggcatcgagctgatgatcctgc ttatcgtgtttgagatcttcgggcagtcgtaccgaggagctatcgcgtac atcttcatcaccttctccatgtggttcatggttgtcacctggctctttgc gccgttcctgttcaacccttctgggttcnagtggcanaanattgtggacn actggaccgactggaacaa
Download
page-top