Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ627090
Length 787 bp
Fasta Format > whcs10c17
ctagccgcctcccgcacgcttctcctccgcctcgagcagctcagggacgc gcgcagccatggcgacggagaccgagaccttcgccttccaggccgagatc aaccagctcctctcgctcatcatcaacaccttctactccaacaaggagat cttcctccgcgagctcatctccaactcctccgatgccttggacaagatca ggttcgagagcctcacggacaagagcaagctcgatgcgcagcccgagctc ttcatccacatcatccccgacaaggcgaccagcacgctcacgatcgtcga cagcggcattggcatgaccaagtcggacctcgtcaacaacctcgggacca tcgccaggtcggggaccaaggagttcatggaggcactcgctgccggcgct gacgtgtccatgattgggcagttcggtgttgggttctactccgcctacct cgtcgccgagagggtcgtcgtcaccaccaagcacaacgacgacgagcagt acgtgtgggagtctcaggccggtggctccttcaccgtcactcgtgatacg tctggggagcagctcggcaggggtaccaagatggtgctctacctcaagga cgaccagatggaataccttgaggagcgccgcatcaaggatctagttaaga agcactctgagtttatcagctaccccatctccctgtggaccgagaagacc actganaaggaaatttctgacgatgaanatgangagganaanaaggatac tgangagggcaaggttgaggatgttgatganganaag
Download
page-top