Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ627085
Length 742 bp
Fasta Format > whcs10c08
tcggcgtacatcagcgaaagataagtttaataatatggttgcaactaagg atgttgtcagagttgtcgagggagcatgtaagggaacacaaggacctgtg gaacacatacataaggggatattgttcatatatgataggcaccaccttga acatgcaggcttcatttgtgcaaaagcacaatcgtgcattcttgtcggtg gatcgactggtggccgtcgtggaaatggtatggatgctgcagatgctagg atgggtgctttgagatccccggcaagcatcttgcagtctccaggaaggct gcccccaagaggaccacaaatgaactatggtggaagatttggaggaggtg gtcgtggtggaagaggacatgatgccttggttggcaagtgtatcaaaatt aaatctggtccttacaaagggtaccgtggccgcgttaaagaggtgactgg ggtgcttgtgcgcgtggagcttgattcgttaatgaagattgtcacagtta agagggatgatattgccgacacacctactgttgcaacaccattccgtgag ccccgattttcgttgggcagtgaaacaccaatgcacccgtctaggacgcc actacatccttttcanactccaatgcgggaccctggagcaacaccgatac atgatggaatgcggaccccgatgcgtantanggcctgggctcctatgant cctccaananataattgggaanatggaaatcctgatacttgg
Download
page-top