Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287725
Length 605 bp
Fasta Format > whsl10j05
agagatgttctgctgaaccttctaaagtcaagatacgcagaactacatga ctttgggtctgaaatcctcccgagagctctgcatgatcaatgtgcaggca tatgtcttcactgactactgggaggacattggaacaatcagatccttctt cgatgcgaacatggccctctgcgagcagcctccaaagtttgaattttatg atccaaaaactcccttcttcacttcgcctcggtacttaccaccaacaaag tcagacaagtgcaggatcaaagaagcgatcatttcgcacggctgcttctt gcgtgaatgcaaaatcgagcactccatcatcggcgtccgttcacgcctaa actccggaagcgagctcaagaacgcgatgatgatgggcgcggactcgtac gagaccgaggacgagatctcgaggctgatgtcggagggcaaggtccccat cggcgtcggggagaacacaaagatcagcaactgcatcatcgacatgaacg cgaggataggaagggacgtggtcatctcaaacaaggagggagtgcaagaa gccgacaggccggaggaagggtactacatcaggtccgggatcgtggtgat ccaga
Download
page-top