Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287712
Length 575 bp
Fasta Format > whsl10i12
ggtctcactggatgcttgacaagcttggtggagcttttgcccccaagcca tcatctggtcctcacaaggccagggagtgccttcctctgatcctcatcct gaggaacagactgaaatatgctctcacctaccgtgaagtgcagtctatcc ttatgcagcgtcatatcatggttgatggaaaggtccgcactgacaagacc taccctgctggtttcatggacatcatttccattcccaagactggtgagaa ctacaggcttctgtatgacaccaagggccgcttccgccttcactctgtca gggatgaggatgctaagttcaagctctgcaaggtcaggtctgtccagttc ggccagaagggcatcccctacctgaacacctatgatggccgcaccatccg ctacccagaccctctcatcaaggccaatgacactatcaagctcgacctgg agaccaacaagattgttgacttcatcaagttcgacgttggtaacgtggtc atggtgactggcgggcgcaacactgggcgtgttggtgtgatcaagaacag ggagaagcataagggaaccttcgag
Download
page-top