Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287711
Length 442 bp
Fasta Format > whsl10i11
ttcggcacgaggctttggtcctgcttctccttctcatcgcacaggnaggc ggcggtgccgggggcggaggcgaaggtctgccggcagcgcagcgcggggt tcaaagggccgtgcgtgtccgataagaactgcgcgcaggtctgcctgcag gaaggctggggcggcggcaactgcgacggacccttccgccggtgcaagtg catcaggcagtgctgatcataatatgtgctacggctagctggccctcgcc gtacgtcagctagctagcccatggaatcatacgtctgtgtacctacttga atgtgtgtgtgtgtgccgccttctacgtacgtatgtcgtatgtatatccg tatcaccactagccagctgctgcatctcgatcgatgcatgcgagagaata ataataagaataaaaacgtacggttcatgttcaaaaaaaaaa
Download
page-top