Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287708
Length 659 bp
Fasta Format > whsl10i06
gccgccagcagctgcgcaaaggctcgacaaaccctaaccctagtccatag ctagcttagcttccttcctctcgatctagctagagccatggcgccgacca agggcgaggggccggccatcggcatcgacctcggcaccacctactcgtgc gtcggcgtgtggcagcacgaccgcgtcgagatcatcgccaacgaccaggg caaccgcaccacgccctcgtacgtcgccttcaccgactcggagcgcctca tcggcgatgccgccaagaaccaggtcgccatgaaccccatcaacaccgtc ttcgatgcgaagcgtcttattggcagaaggtttgctgatgcccctgtcca gagtgatattaagatgtggccgtacaaggttattcctggccccgcagaca agcctatgattgtagtgcagtacaagggtgaggacaagcagttctcagct gaagaaatttcttccatggtcctcatcaagatgcgtgagatcgctgaggc ttacctaggagtaactattaagaatgctgttgtcaccgtgcctgcttact tcaatgattcccagaggcaggcaaccaaggatgccggtgttattgctggt cttaatgtgatgcgtatcatcaacgagccaacagcagctgcaattgctta tggtcttga
Download
page-top