Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287707
Length 568 bp
Fasta Format > whsl10i05
ggttcatggccggnggggaatcagctgcccctccaggagcgcggcgggag atccctccgccctgcccgcgcttggcaacagcgttctactgcccaggtac cactcgacagagaaacacgacgacagtgacacgctgggcgaaatcggaga gaaggcaagaacgacggcggaggagttcctgaagatggccaaggagaaga ccgacgacgtcgccgagggcgcaaaggagacggtgcaggagaccaaggaa gcggtgctcggcgagtcggacgacgagaaggagaagttcaagcagagggt cgagcaggggaggtaccatcagaaataagtggcggctgctccgctgcact gcctctatacttgcacgcagacagacatggcctgtcgaggtcgttagctc tgcagtttgtatgtcgtcaaccactaggtttggtatctaggtgctatgtg taatgtttcttcccccttcagttcagtggccttcagtactacaatgtgat cttggtgctatacaacttgccacttcccgcagaataaataatgctgagcc tctgaattaaaaaaaaaa
Download
page-top