Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287704
Length 602 bp
Fasta Format > whsl10h20
ttacaagcagtgacacaacgtttcccagttgaggttgtagtagcaaggca ggcagagagagcaatggcttccggtcagcaggagaggtcgcagctggacc gcaaggcccgcgagggcgagaccgtcgtccccggtggcaccggcggcaag tccctcgaggcgcaggagaacctcgccgaagggcgcagccgtggcgggca gactcgcagggagcagatgggggaggaggggtacagccagatggggcgca agggcgggctgagcaccaacgacgagtccggcggcgaccgcgccgccagg gagggcatcgacatcgacgagtccaagttcaagaccaagtcctagatgat ctgttaccctagcaagcaagacgaatctccttaggtcggctgttggtttg ccctagtgtctacgtaccgaataatgtagttcaggcgcacgtaggcgatc gtacgtagtatgatcatgtgtgcttcgtagctggtagtctgtagctactc tacggtgagtagcgtcaggttaagtcggaagcgtactgtggcttggtcag gtggctggtctgcctctgggcccaggagtgtcgcagtgtccactgtatcc tt
Download
page-top