Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287702
Length 567 bp
Fasta Format > whsl10h18
aggcacaacagctcaaggcaaacaccgcgccatctcaaagtggtcagcag tagcacccgtacgcacggaagggacgagccatggcgtctggggcggtgag acctaagctcgcgtacatcgtctgttacgtcgacgacgtggtcaaggcgg ccgccttctacgccgacgctttcggctacagcgtccgccgcgtcgacgac tcgcacaagtgggcggagctggacaccggctcgacgaccatcgcgttcac gccgcggcaccagagggagacggacgcgctcacgggcgaggtgcagctgc ccaagtcgccccgtgagcgagggcccgtggagatctgcttcgactacgac gatgtcgacgccgcgtaccggcgggccgtggagaacggggcggtgccggt aagcgcgccggagcagaagaactgggggcagaaggtcggctacgtcaggg attttgacgggatcaccgtgcgccttgggagccacgtccgcgagtagtgg catccttgctcgtgtctactgtaatgactagtaatgctgtactctgtcga tagcaaataataaatcg
Download
page-top