Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287699
Length 564 bp
Fasta Format > whsl10h13
actgtgtttgccagagatatggttgaggcattatcgttctcaaatatgta tgctcctgagcatttgatcatcaacgtaaaggatgctgagcaatgggagg agctcatcgagaacgcagggtcagttttcttgggacaatggacccccgag agcgtgggtgactatgccagtgggacgaaccacgtcctcccaacctacgg ttacgcgaggatgtacagcggtgtgtcgctgaactctttcctcaagtaca tcactgttcaatccctgactgaagaagggctgagaaggctgggcccctac gtcgcaaagatggcagaagtcgaagggctagaagcgcacaagcgagctgt taccctcagactgcaagaggtcgaagccactgtaactgtgtaaactgtta gcatggtctgttgtgccagtctatttgatgcttggggactgatatttttc ttcatttttatcggatggaacttgccagagtttaaggtgaagaatacgaa gctgtttcatggaataatgctacttatgtcgatctgttaaatgaataaac ttgtgagcaaaaaa
Download
page-top