Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287697
Length 258 bp
Fasta Format > whsl10h10
gatggaaccccgttccgtgcatggttttctataatgctgccaatgccgca ctgattaacttcttcgagacgctgcggtcggagcttggcagtgaagttgg catcacgatagtgacgcccgggtggatcgagtccgagatgtccaaaggaa agtttctgaaggaggacggcggcgtggaggttgatcaagaatatcgagat gctcaaattggcctctttccagtggagtacgccaagaagtgcgcgagggc catggtgc
Download
page-top