Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287696
Length 425 bp
Fasta Format > whsl10h07
gggacggcgttctgcggccccgccggcgcccacgggcaggcgtcctgcgg caagtgcctccaggtgaccaacccggcgacgggggcgcagatcacggcga ggatcgtggaccagtgcgccaacggcgggctggacctggactgggacacc gtcttcaccaagatcgacaccaacgggatcgggtaccagcagggccacct caacgtcaactaccagttcgtcgactgccgcgactagattacgttctccg tcgatcgatcaaagggctagctagctatgataagaataaaaggctagcta aaagtaagttgagactgatccatgctgttaaataaaagctagcacgtgat gctgcattgtatacgtgttacgtgtatacagtacgtacatggaacgaaat aaagtggaacagaccaaaaaaaaaa
Download
page-top