Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287695
Length 503 bp
Fasta Format > whsl10h01
gagaagccctagcttgttcacctaaagagaaccaacggctttgctccatc cacccacctacccccacagaagcaaatggagttcaagccgaaggcgaccg tgtgcgcggtgatgctggtgctgctcctgctttcctcatacgacagcggc ggcgtcggcgtggcggaggcgcgcatttgcacggggaagagccagcacca ctcgttcccgtgcatctcggacaagagctgcaccaagacgtgcctcagcg agcacggcgcaaaatggacggccggctactgcaaattcaggcgctgcacc tgccagagggagtgctagggcagacgctccgcgcggcgagctccaccacc cccgcccgtccatggcgccgccagtcacctatgtatcttaactaccatgt acccactcgccgcctctgtcgggtgatgtaataaaacgtggcgcgcaccc gccggcgcgtcaccggtgtacgtagcatgatgcatgccacgcgttgcttc cag
Download
page-top