Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287692
Length 513 bp
Fasta Format > whsl10g15
gcgcgcactcctcctcctcgccgtcgtcgtctccggtccccgccgctcca cgcgaccatgtcgtcgaagaggaagaccagggagcccaaggaggagaatg tcacccttggaccggctgtccgtgagggagagcatgtctttggcgttgct cacatctttgcatccttcaatgacactttcatccatgtgactgacttgtc tgggagggaaaccctggtgcggatcactggtggaatgaaggtcaaggctg atcgtgatgagtcttcaccctatgctgctatgcttgcatctcaggatgtt gctacacgttgcaaggagcttggtattaccgcactgcacattaagctccg tgccactggaggcaacaagaccaagacacctggacctggagctcagtctg ctctcagggctcttgctcgttctgggatgaaaattgggcgcattgaggac gtgactccagttnccactgacagcacccgccggaagggaggaaggagggg aaggaggctgtag
Download
page-top