Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287690
Length 656 bp
Fasta Format > whsl10g12
actagctaatacggtgcactgttagctacagaccaagaagtgatcatggc ccgcgctcaggtaatgctcatggccgtcgccttggtgctgatgctcgcgg cggtcccgcgcgctgccgtggccatcgactgcggccacgttgacagcttg gtgagaccctgcctgagctacgttcagggcggccccagcccgtctgggca gtgctgcggcggcgtccagagcctccataaccaggcgcaatccaagagcg atcgccaagccgcttgcaactgcctcaaggggatcgctcgtggcatccac aatctcaacgaggacaacgcccgcagcctcgcccccaagtgcggtgtcaa cctcccataccacatcagtctcgacatcgactgcaacagtgtgtaatgag cgacgatccgtcaagctggtgctcagctcatccatccacgtggagttgaa gcgcgcagcctctatccctatgtagtatgggcactagttatgcgagttta tactgaatatgaataagaactctctcctgctggcttgctggtactcctct ggaggagatcagtatctgtgtatctgagagttgagagtttgtaccatggg cactcccagtgtttatggacttttatacatacagctcgttctgttcaaaa aaaaaa
Download
page-top