Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287685
Length 604 bp
Fasta Format > whsl10f20
gctagagcacaagcatcaaatccaagtaggtagtagttaacgcaaatcca ccatgaagaccttactcatcctgacaatccttgcgatggcaataaccatc gccaccgccaatatgcaggccgaccctagcggccaagtacaatggccgca acaacaaccattcctgcagcctcaccaaccattctcccagcaaccacaac aaatatttccccaaccccaacaaacattcccccatcaaccacaacaacct tttccccagccccaacaaccgcaacaatcattcccccaacaacaaccatc gttgattcaacaatctctacaacaacagttgaacccatgcaagaatttcc tcttgcagcaatgcaaacctgtgtccttggtgtcatccctctgttcaatc atcttgccaccaagcgattgccaggtgatgcggcaacaatgttgtcaaca actagcacaaattcctcagcaactccagtgtgcagccatccatagcgtcg tgcattccatcatcatgcagcaagaacaacaagaacaactacagggtgtg caaatcctggtgccactgtctcaacagcaacaggtgggtcaaggtattct cgtc
Download
page-top