Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287679
Length 342 bp
Fasta Format > whsl10f07
gcacaactccaccggtagtaacaaagccgtacgtagcgcaagcagagagt ttaggtcgctcccagcccggccgctcaccatgtggaccaagaaggtggcg acgcaggtggctttggtcctgcttctccttctcatcgcacaggaggcggc ggtgccgggggcggaggcgaaggtctgccggcagcgcagcgcggggttca aagggccgtgcgtgtccgataagaactgcgcgcaggtctgcctgcaggaa ggctggggcggcggcaactgcgacggacccttccgncggtgcaagtgcat caggcagtgctgatcataatatgtgctacggntagctggncc
Download
page-top