Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287674
Length 506 bp
Fasta Format > whsl10e21
agaagttgcttcaaagaagaggaagcaccaagaggaagaacctactgcgg aggcagctgaacaggacggcgagcaggagaaagagaagtccaagaagaag aagaagaaatccaaggacatcgaggagactccagcagccgtcaccgacgc tagcgagaagaagaagaaaaagaagagcaaggaggccgaggacacccctg cagccaacaccgacggtgagaagaagaaaaagaagaagaaatcagacgct gaggacgcccccatggaggttgacgtgtctgccaagaaggagaagaagaa aaagaagaagcacgctgacgagtgagcggcatggagatacgccggaaatt tgtggtgtaatgctgtactatcatcgttgtctgaaagttttgggacttgc cgttcatgtagaatggaatgccacattaggattagcagcgacgaacccta caattcgaaacttgcaagtggtgagcagtcactttaagaggcccatanna aaaaaa
Download
page-top