Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287672
Length 636 bp
Fasta Format > whsl10e18
ctaccccaagtcaaggtactgccgtggtgtgcctgaccctaagatcagga tctatgatgtcggcatgaagaagaagggtgtcgatgagttctctcactgt gttcaccttgtctcatgggagaaggagaatgtgtccagtgaggctcttga ggctgcccgtattgcttgcaacaagtacatgactaagcatgcaggaaagg atgccttccacctcagggtcagggttcacccgttccatgtgctccgtatc aacaagatgctttcgtgtgccggggctgataggctccagactggtatgag gggtgctttcgggaagccgcagggagtctgtgcccgtgttgccattgggc aggtcctcctttctgtgcggtgcaagcccaacaatgccatccatgctact gaggcccttcgtcgtgccaagttcaagttccctggccgccaaaagatcat tgagagcaggaagtggggcttcaccaagttcaaccgcaatgactacctca agttcaagagtgagggcaggatcttgcctgatggagtcaacgctaagctg ctcggatgccatggccgccttgcaaaccgtgcccctggacaagctttcct gtctgctgcataatctagcagaagaagtctatccgt
Download
page-top