Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287671
Length 576 bp
Fasta Format > whsl10e13
acggtgcactgttagctacagactnagaagtgatcatggcccgcgctcag gtaatgctcatggccgtcgccttggtgctcatgctcgcggcggtcccgcg cgctgccgtggccatcgactgcggccacgttgacagcttggtgagaccct gcctgagctacgttcagggcggccccggcccgtctgggcagtgctgcgac ggcgtcaagaacctccataaccaggcgcgatcccagagcgatcgccaaag cgcttgcaactgcctcaaggggatcgctcgtggcatccacaatctcaacg aggacaacgcccgcagcatcccccccaagtgcggtgtcaacctcccatac accatcagtctcaacatcgactgcagcagggtgtaatgggcgacgatccg tcaagctggtgctcagctcatccatccacgtggagttgaagcgcgcagcc tctatccctatgtagtatggtcactagttatgcgagtttatactgaatat gaataagaactctctccagctggcttgctggtactcctctggaggagatc agtatctgtgtacctgagagttgaga
Download
page-top