Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287664
Length 666 bp
Fasta Format > whsl10d21
cgaggggtaatcccaatccccacagaaatccccatctcaaaaccctagcc ctcatccccgatcccggcgagcgagatggccaacccgagggtgttcttcg acatgaccgtcggcggcgcgccggccgggcgcatcgtgatggagctgtac aaggacgcggtgccgcggacggtggagaacttccgcgcgctgtgcaccgg cgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagcg ccttccaccgcgtgatccccgacttcatgtgccagggcggcgacttcacc cggggcaacggcaccggcggcgagtccatctacggcgagaagttcgccga cgagaagttcgtccacaagcacaccaagcccgggatcctctccatggcca acgcggggcccaacaccaacggctcccagttcttcatctgcaccgtcccc tgcaattggctcgacggcaagcacgtggtcttcggcgaggtcgtcgaggg catggacgtcgtcaagaacatcgagaaggtgggctcccgcagcggcacct gctccaagcaggtggtcatcgccgactgcggccagctctagatccgcccg cgcgcgggtcgcctttcgccgtcgtcgtcgccgncccgtgtgtcccgtgt cgtgtcgtcgatctaa
Download
page-top