Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287663
Length 612 bp
Fasta Format > whsl10d19
gccgaaccnaancaggagcgagtcccttctagagagccccttgagagtcg cctgtagcttccccgatcccgcccgatccccaatctccgacgacggcgat gccggccggacgagagatgggagaggtgtgtggagatctgtaaatagcag gtctaggattagatcgagtcttgcccaagtggtgtctggcgctatgccgt ggtggagcgcgccgccggcgcacgcgagctgcgcctggtggctagcgtcg gcgtttctgatggttgcggtggcgaggtgctgcgtgcaaccggaggaaat gacggcggcgactccttcaataagctcgttgtgtttcctgttaaggtgga ggcccggctgctctaccctttcttttcaagccatcgtggtggtggatgga ggaagaaggagaggcggcgagctggactttgcagtttgggaaggagctca tcctcaatgggtttgagacgaggcaacggcgcccgcttcggctgtcggca gccggtcctcaccgtctcgccattgaatatgctggccgaagggcggccct ttctcttcctcccggcctggtgcctagatgggaggcagttcatctccgaa tcggagtctaag
Download
page-top