Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287661
Length 562 bp
Fasta Format > whsl10d15
cgctggaaaagatgacaagggtcttaagacttatgatcctggttatctca acactgcccctgtgcgttcttccatctgctacattgatggggatgaggga attcttcgctacaggggttatccaattgaggaggttgctgaaagcagttc gtttgttgaggtcgcctacctcttaatgtatgggaatttgccttctcaga gtcaactggcagcctgggagtttgcaatttcacagcactctgctgttcct caaggactcttggatatcatacaatcaatgcctcatgatgcccaccccat gggtgtccttgccagtgcaatgagcacactttctgtcttccacccagatg caaaccctgcccttagagggcaagatctgtacaactcaaagcaggttagg gataagcaaattgtgcgagttcttgggaaggcaccagcaatagcagctgc agcctacctgagactagcaggaaggcctgccgtccttccttcaaataatc tttcttattcagagaatttcttgtatatgctagactctttgggtgacaaa gaatataagcca
Download
page-top