Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287652
Length 344 bp
Fasta Format > whsl10c15
gccgccgcgatgagggccaagtggaagaagaagaggatgaggaggctcaa gaggaagcgccgaaagatgaggcagcgatccaagtaggcgccttggagca ggggaagcatcatcctacatccaggctgccaggcatcgagggaggacggc atggtctagtgattcctggcgtgtttgctgctatggctgtggaagctgtc ttacctgtgttctgtccaatttagctgtttaatgctagtctggttttgtt ccaagactgagttttatgtaatgtgggattatatgtgtttgtgactgaat tttatgcagctattaattttgcagtactcttgataaaaaaaaaa
Download
page-top