Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287649
Length 655 bp
Fasta Format > whsl10c03
ggctgcaggnaattcggcacgaggctctggtttgctactgctggtgctca tcggactccccgacgccgccgtcgccgccaacatggccgaggtctgcgtc aaggccgccgtcggccaccccgacacgctcggcgactgtcccttctccca gagggtgctgctcacgctggaggagaagaaggtgccctaccagatgaagc tcatcgacgtcagtaacaaggccgactggttcctgaagatcaatccggag ggcaaggtgcctgtgtataacggtggtgatggcaaatggattgctgattc tgatgtgatcactcaagtcattgaggagaagtacccaactccatcacttg tgacccctcctgagtatgcatcagtgggatcaaagatcttctccaccttc gtcacgttcttgaagagcaaggatgccagcgatggttcggagaaggcact tgttgacgagctgcaggcactcgaagagcacctgaaggcccatggaccct acatcaacggggcgaacatctccgccgtcgatctcagcctggctccgaag ctctaccacctccaggtcgccctggagcacttcaagggctggaaggtccc tgaaaccctgaccagcgtccatgcctacaccgaggctctcttcagccgcg agtcg
Download
page-top