Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287648
Length 518 bp
Fasta Format > whsl10b24
ggctttgctccatcaacctacctacccccacagaagcaaatggagttcaa gcccaaggcgaccgtgtgcgcggtgatgctggtgctgctcctgctttcct cctacagcggcggcggtggcatcggcgtggcggaggcgcgcatttgcacg gggaagagccagcaccactcgttcccgtgcgtctcggacaagagctgcac caagacgtgcctcagcgagcacggcgcaaaatggacggccggctactgca aaatcaggcgctgcacctgccagagggagtgctagggcagacgctccgcg cgcgagctcccccacccccgccccgtccatggcgccgtctgtcaaacgaa gccacctatgtatcttaagtcttaactaccatgtacccactcgccgcctc tgtcaggagatgtaataaaacgtggcgcggcgacccgccggcgcgtcacc gctgtacgtagcatgatgcatgccacgcgttgcttttggtaacaaaataa attgatttaaaaaaaaaa
Download
page-top