Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287645
Length 609 bp
Fasta Format > whsl10b20
gggcgccaaggnacgcaaccgttgatacaggggagggcgccaaggagtac atggtggacaaggaggaggacgcccggcgagcgctcgccggctcggccaa ggatagcgagggcgagacgaaggagtcggcgtggcaacagggccaggatg tgcggcggcgggcggcggagaaggccgaggaggctcgtcagcgcacgcac caaccaccggaggaggagaggtcgaagttggcaacggagaacatcttcgg gtcggcgcaggggttgacggaggcgttcaaggagaagatgacgatgccga cggacgtgatcgagcggaagctcgctgagaggaaggggacgacaagggac gcgggcaggggcgaggcactgaacgcggacgacgtgatgatgcgcgtgaa ggaggcggaccagatgaccgggacagggtttaacgacgtcggcaagatgg gcgaggagggcaccggcatgaaggcggcactgagggccgacgacgaggag gacgtgatgctgcgggtgaaggcggcggaccagatgacagggcaggcgtt caacgacgtcggcccgatgggcgaggagggcacgggatggggtccggcat tgagggcgc
Download
page-top