Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287642
Length 585 bp
Fasta Format > whsl10b08
gcccatcctccccgacccctctccccccaggtaagcccgcggcggcggcg agcgagcggcggctatgacgacccgcctcaagaagaaccgcaagaagcgc ggccacgtgtccgccgggcacgggcgtgtgggcaagcaccgcaagcatcc tggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctcttcg acaagtaccatcccggctacttcggcaaggtcggtatgcgctacttccac aagctcagcaacaggttctacactccgacgatcaacgtcgagaggctctg gtccatggtaccggccgagaaggcggcagaggccggcggtgacaaggccc ccgtggtcgacgtctcgcagttcggctacttcaaggtgctcggcaagggg atgctgccggagaagcccatcgtcgtcaaggccaagctcatctccaagat cgccgagaagaagatcaaggccgccggcggcgctgtcgtgctcgttgcct agggttctgttcgcgactgtgccttgagatctattatatctttactatta gttgtttcccgtaccagcaatttgtgttgaacaag
Download
page-top