Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287641
Length 665 bp
Fasta Format > whsl10b06
gagcaccacctcctccctccatncctgatccgatctgactgagccggcca tggcggttagggtttggctctccgccatcctcctcgccttcctcctcgcc gcctcccccttcgcccaagttgctagagctcagtctgaggaagatgctgc tatgcaagaagttgttgatggggctgatctaggatatgtgggtgatgata ctccggtttccagtgaagagcctttaagccctgctcctggtgtggagact gtttgcgtcttccccaaaaacgctgggaaaattgtaccagcaggtgaaga aactgagcttttggttggcctgcaaaatgagggtgaatcaactttgaatg ttgttgctgtccattcaaccctgcatcttccttatgatcacaaaatgtat ggacaaaaccttacagttcagagtttctacaacgcgtcagttcctgtctc tgtgcaagcaacctttccctatacatttgccgtgagcaaattcttgcagc ctggagcatatgatcttgttggttacattgtgtacgagattgatcagcac ccttaccagaacgtattctacaatggcaccattgaggttgttgaggtcgg agggttactgagtgttgaatctgtgttccttattacccttggaattgcac ttcttggtctcctag
Download
page-top