Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287634
Length 664 bp
Fasta Format > whsl10a16
gagagctccagccatggtgcacgtcaacttctaccgcaactatggtaaga cattcaagaaaccaaggcgtccttatgagaaggagcgtcttgatgcagaa ctaaagctggtcggtgaatatggactgaggtgcaagcgtgagctctggag ggttcagtatgcactgagcaggattcgtaatgctgcaagacacttgctca cactggatgagaaaaatccccgccgtatctttgagggcgcggcccttctc cgtcgcatgaaccgctatggtctccttgctgagggccaggataagcttga ttacgtccttgccctgactgctgagaacttccttgcaaggcgccttcaga ctcttgtcttcaaggctggcatggcaaaatccatccaccatgcccgtgtc ttgatcaggcaacgccacatcagggttggcaggcagatcgtcaatgtccc ctcgttcatggtgagggttgaatctgagaagcacatcgacttctcactga caagtccattcggtggaggccctgcaggcagggtgaagagaaagaaccag aagaaggcaagtggtggcggtgacgccggtggtgacgaggaagaggaatg aggaactagtagctatcaccttatatttatcaaatgttggtgttatgagt actttagctgagag
Download
page-top